Yesteryear Chronicle Search
A look back in time


Submit search query to Yesteryear Chronicle Search via this form

Select Chronicle to search:


Search term: cloning

Top Results

  1. Clone is a alter knowledge recombine dna technolog remove flaw
  2. Clone is a clone finally
  3. Clone is a copy person
Knowledge Base Information:
Additional Search Terms:
Consensus (e.g., assembly full length cdna clone -> Corona: Fifteen DNA fragments, represented by turquoise bars, were amplified 526 by PCR from the respective plasmid DNA clones containing the consensus SeACoV-p10 527 genomic sequence and assembled into a full-length cDNA clone, pSEA, by using the GeneArt 528 High-Order Genetic Assembly System (Invitrogen).).
Full Length Cdna Clone Pdcov (e.g., assembled panel adjoining fragment -> Corona: The full-length cDNA clone of PDCoV was assembled from a panel of six adjoining fragments using in vitro ligation; an approach successfully utilized for developing the infectious clones of TGEV, MHV, IBV, NL63, SARS-CoV, MERS-CoV, and PEDV [27,31 36].).
Clone Like Twin Don T Act Alike (e.g., break animate human -> med: Clone like twin don t act alike is a break animate human,  extinct clone breed increase number break animate -> med: Clone like twin don t act alike is a extinct clone breed increase number break animate,  like read letter animate extinct clone breed -> med: Clone like twin don t act alike is a like read letter animate extinct clone breed).
Bilateral Breast Pattern Breast Ovarian Bowel Endometri (e.g., clone autosom domin autosom recess link -> med: bilateral breast pattern breast ovarian bowel endometri is a clone autosom dominion autosom recess x link,  conflict high risk gene clone autosom domin -> med: bilateral breast pattern breast ovarian bowel endometri is a conflict high risk gene clone autosom dominion).
Final Pcr Product (e.g., clone bac infectious clone -> Corona: The final PCR product was cloned into the BAC infectious clone through an intermediate plasmid containing nt 18404 26049 of the SARS-CoV genome (16, 43).).
Fragment (e.g., clone pcmv mcscopgfp vector clone site -> Corona: These two fragments were sub-cloned into the pCMV-MCSCopGFP vector (clone sites and primers used are listed in Table I), forming the expression plasmids pCMVMCS-upE and pCMV-MCS-1bN.).
Hierarch Model Cancer Cell Populate Fit Datum (e.g., compo distinct clone hand stem cell state -> med: Hierarchs model cancer cell populate fits data is a compo distinct clone hand stem cell state,  evid cancer compo distinct clone hand stem -> med: Hierarchs model cancer cell populate fits data is a evid cancer compo distinct clone hand stem).
Clone Erythropoietin Produce Human Hepatocellular Carcinoma Cell (e.g., conserve mammalian specie -> med: Clone erythropoietin produce human hepatocellular carcinoma cell is a conserve mammalian specie,  highly conserve mammalian specie -> med: Clone erythropoietin produce human hepatocellular carcinoma cell is a highly conserve mammalian specie).
Consensus Sequence Seacov P10 (e.g., construction infectious clone -> Corona: Nucleotide sequence accession number 385 The consensus sequence of SeACoV-p10 used for construction of the infectious clone has 386 been deposited in GenBank under accession no. MK977618. 387 388 Acknowledgments 389 This work was supported by the National Key Research and Development Program of China 390 (2016YFD0500102), the National Natural Science Foundation of China (31872488), and the 391 Fundamental Research Funds for the Central Universities of China (2019FZA6014).).
Shrna Expression Plasmid (e.g., constructed series cloning step -> Corona: Next, an shRNA expression plasmid was constructed through a series of cloning steps (Supplementary Figure 1).).
Sequence (e.g., corrected basis different clone fragment -> Corona: Consensus sequences were assembled from both forward and reverse sequences, edited manually, and corrected on the basis of the different clones of a fragment.).
Infectious Clone (e.g., creation homogen viral stock -> Corona: Infectious clones allow the creation of near-homogenous viral stocks, whereas traditional viral stocks are prepared by amplification of infectious material in cell culture over many passages.,  designated macmut -> Corona: These infectious clones were designated MACmut, PLP2mut, and 454 MAC/PLP2, according the locations of introduced mutations as shown in Figure 1. 455 Temperature-sensitive assay and one-step growth kinetics.,  generated reverse -> Corona: All infectious clones were generated using the reverse 443 genetics system previously established for MHV-A59 (37).).
Recombinant Wt Mer Cov Mutant (e.g., derived emc 2012 strain cdna clone -> Corona: Recombinant WT MERS-CoV and mutants were derived from the EMC/2012 strain cDNA clone, all by introducing mutations into cDNA fragment F assembling the genome fragment and recovering infectious virus as described previously (27).).
Fulllength Infectious Cdna Clone (e.g., derived highly virulent tgev strain wh 1 genbank -> Corona: The pBAC-TGEV-GFP plasmid containing a fulllength infectious cDNA clone, which was derived from the highly virulent TGEV strain WH-1 (GenBank accession number HQ462571), has been described previously (19).).
Total 24 Clone Homogeneous Cell Population (e.g., exhibited higher susceptibility -> Corona: A total of 24 sub-cloned homogeneous cell populations exhibited higher susceptibility to PEDV infection, as demonstrated by PEDV N protein-speci?c IFA (data not shown).).
Support Idea Expand Clone Precanc Cell Tissue (e.g., gene involve dna repair control mutate rate -> med: Support idea expand clone precanc cell tissue is a gene involve dna repair control mutate rate,  monitor period month year mutate gene involve -> med: Support idea expand clone precanc cell tissue is a monitor period month year mutate gene involve).
Recombinant Merscov (e.g., generated bacterial artificial chromosome bac clone -> Corona: Recombinant MERSCoVs were generated by a bacterial artificial chromosome (BAC) clone carrying the full-length infectious genome of the EMC isolate (designated as pBAC-MERS-wt), as described previously (Terada et al., 2017; Matsuyama et al., 2018) with modifications.).
Catalytically Inactive Phosphodiesterase Domain (e.g., generated mer cov infectious clone -> Corona: MERS-NS4bH182R encodes NS4b with a catalytically inactive phosphodiesterase domain, which was generated from the MERS-CoV infectious clone as previously described (19, 27).).
Human Dpp4 Gene Hdpp4 Tg Mouse (e.g., generated 328 microinjection purified bac clone -> Corona: TMPRSS2-/- mice with a homologous genotype were obtained 328 by crossing male and female TMPRSS2+/- C57BL/6 mice (20). 329 The transgenic mice expressing human DPP4 gene (hDPP4-Tg mice) were generated by 330 microinjection of the purified BAC clones carrying hDPP4 gene into the pronuclei of 331 fertilized eggs from BDF1 C57BL/6NCr mice (Iwata-Yoshikawa et al., submitted).).
Total 120 Blue Clone (e.g., grow sd trp leu -> Corona: After three rounds of screening on plates with different nutrient-deficient media, a total of 120 blue clones that grew on the SD/?Trp/?Leu/?).
Total 108 Blue Clone (e.g., grow sd trp leu ade - gal -> Corona: After three rounds of screening on di?erent nutritionallyde?cient medium plates, a total of 108 blue clones that grew on the SD/ ?Trp/?Leu/?Ade/-His/X-?-Gal/AbA were visible and identi?ed by PCR (Fig. 2B and C).).
Clone Ipi Fx Cell Line (e.g., ideal cell model -> Corona: Thus, this sub-cloned IPI-FX cell line is an ideal cell model to study the mechanisms of infection, particularly co-infections of swine enteric CoVs. 1.).
Entire Genome Sequence Rescued Viruse (e.g., identical cdna clone -> Corona: As shown in Figure 1C and D, the entire genome sequences of rescued viruses were identical to the cDNA clone, including the genetic markers at position 6857, 15616, 23753 and the Emerging Microbes & Infections 21 junctions between six fragments, thereby suggesting that the rPDCoV was successfully rescued in LLCPK1 cells.).
Full Length Pdcov Cdna Clone (e.g., illustrated figure -> Corona: Assembly of a full-length cDNA clone of PDCoV The cloning strategy for a full-length PDCoV cDNA clone is illustrated in Figure 1A, using six contiguous fragments ?anked by the BsmBI restriction endonuclease sites that leave nonpalindromic overhangs.).
Purified Bac Clone (e.g., microinjected pronuclei 513 -> Corona: The purified BAC clones were microinjected into the pronuclei of 513 o n January 11, 2019 by guest http://jvi.asm.org/ D ow nloaded from 28 fertilized eggs from BDF1 C57BL/6NCr mice (SLC Inc., Hamamatsu, Japan) and then 514 transplanted into pseudopregnant ICR mice (SLC Inc.).).).

Music for cloning

Links discovered for Corona

No results found. Consider simplifying your search query, or search a different Chronicle.

Check out these general matches for cloning.
  1. med: Clone is a alter knowledge recombine dna technolog remove flaw
    Clone isa alter knowledge recombine dna technolog remove flaw.
    Derived fact

  2. Corona: All these seven clones were further sub-cloned and finally, mAbs S1-6E6, RBD-14F8, RBD23D3, RBD-25E4, RBD-40G7, RBD-43E4 by S?TM, and S2-14H8 by S2 were purified and characterized for IgG subclass and light chain type (Table 3).
    Clone isa clone finally.
    Derived fact.
    Clone_isa_clone_finally

  3. med: Clone is a copy person
    Clone isa copy person.
    Derived fact

  4. Corona: A homogeneous cell line, designated IPI-FX, obtained from IPI-2I cells by sub-cloning with limited serial dilutions, was found to be highly susceptible to pedv.
    Clone isa find susceptible pedv.
    Derived fact.
    Clone_isa_find_susceptible_pedv

  5. med: Clone is a like twin don t act alike don
    Clone isa like twin don t act alike don.
    Derived fact

  6. med: Clone is a save endang specie like panda siberian tiger
    Clone isa save endang specie like panda siberian tiger.
    Derived fact

  7. Corona: Clones were screened for dpp4 expression and susceptibility to MERS-CoV replication.
    Clone isa screened dpp4 expression susceptibility.
    Derived fact.
    Clone_isa_screened_dpp4_expression_susceptibility

  8. med: Clone is a treatment repair damage cell dna gain
    Clone isa treatment repair damage cell dna gain.
    Derived fact

  9. med: Clone is a twin don t act alike don t
    Clone isa twin don t act alike don t.
    Derived fact

  10. med: Clone is a twin separate unusual long time period
    Clone isa twin separate unusual long time period.
    Derived fact

  11. med: Clone is a alter knowledge recombine dna technolog remove flaw copy person
    Clone isa alter knowledge recombine dna technolog remove flaw copy person.
    Derived fact

  12. med: Clone is a copy person alter knowledge recombine dna technolog remove flaw
    Clone isa copy person alter knowledge recombine dna technolog remove flaw.
    Derived fact

  13. med: Clone is a copy person like twin don t act alike don
    Clone isa copy person like twin don t act alike don.
    Derived fact

  14. med: Clone is a like twin don t act alike don copy person
    Clone isa like twin don t act alike don copy person.
    Derived fact

  15. med: Clone is a like twin don t act alike don twin don t act alike don t
    Clone isa like twin don t act alike don twin don t act alike don t.
    Derived fact

  16. med: Clone is a twin don t act alike don t like twin don t act alike don
    Clone isa twin don t act alike don t like twin don t act alike don.
    Derived fact

  17. med: Clone is a twin don t act alike don t twin separate unusual long time period
    Clone isa twin don t act alike don t twin separate unusual long time period.
    Derived fact

  18. med: Clone is a twin separate unusual long time period twin don t act alike don t
    Clone isa twin separate unusual long time period twin don t act alike don t.
    Derived fact

  19. med: Clone is a twin separate unusual long time period treatment repair damage cell dna gain
    Clone isa twin separate unusual long time period treatment repair damage cell dna gain.
    Derived fact

  20. med: Clone is a treatment repair damage cell dna gain twin separate unusual long time period
    Clone isa treatment repair damage cell dna gain twin separate unusual long time period.
    Derived fact

  21. med: Clone is a treatment repair damage cell dna gain save endang specie like panda siberian tiger
    Clone isa treatment repair damage cell dna gain save endang specie like panda siberian tiger.
    Derived fact

  22. med: Clone is a save endang specie like panda siberian tiger treatment repair damage cell dna gain
    Clone isa save endang specie like panda siberian tiger treatment repair damage cell dna gain.
    Derived fact

  23. CommonKB: Clone is a ringer
    Clone isa ringer.
    Derived fact

  24. CommonKB: Clone is a dead ringer
    Clone isa dead ringer.
    Derived fact

  25. CommonKB: clone is a clone
    Clone isa clon.
    Derived fact

  26. CommonKB: Clone is a knockoff
    Clone isa knockoff.
    Derived fact

  27. ConceptNet: Clone is a twin
    Clone isa twin.
    Derived fact

  28. ConceptNet: Clone is a copy
    Clone isa copy.
    Derived fact

  29. med: Bisulfit convert tumor dna colorectal cancer patient is a amplify mlh1 locus subject topo ta clone
    Bisulfit convert tumor dna colorectal cancer patient isa amplify mlh1 locus subject topo tum clone.
    Derived fact

  30. med: Biopsy is a analyze hpv dna pcr clone sequence
    Biopsy isa analyze hpv dna pcr clone sequence.
    Derived fact

  31. med: Learn is a animate experiment like clone
    Learn isa animate experiment like clone.
    Derived fact

  32. Corona: An Analogous cloning strategy has been independently applied in the construction of a vector that was intended to silence two endogenously expressed genes simultaneously.
    Analogous cloning strategy isa applied construction vector.
    Derived fact.
    Analogous_cloning_strategy_isa_applied_construction_vector

  33. med: Type clone map genome define molecular is a assemble correctly
    Type clone map genome define molecular isa assemble correctly.
    Derived fact

  34. Corona: Fifteen DNA fragments, represented by turquoise bars, were amplified 526 by PCR from the respective plasmid DNA clones containing the Consensus SeACoV-p10 527 genomic sequence and assembled into a full-length cdna clone, pSEA, by using the GeneArt 528 High-Order Genetic assembly System (Invitrogen).
    Consensus isa assembly full length cdna clone.
    Derived fact.
    Consensus_isa_assembly_full_length_cdna_clone

  35. Corona: The Full-length cdna clone of pdcov was assembled from a panel of six adjoining fragments using in vitro ligation; an approach successFully utilized for developing the infectious clones of TGEV, MHV, IBV, NL63, SARS-CoV, MERS-CoV, and PEDV [27,31 36].
    Full length cdna clone pdcov isa assembled panel adjoining fragment.
    Derived fact.
    Full_length_cdna_clone_pdcov_isa_assembled_panel_adjoining_fragment

  36. med: Steen willadsen create people identical clone is a bad
    Steen willadsen create person identical clone isa bad.
    Derived fact

  37. med: Clone like twin don t act alike is a break animate human
    Clone like twin don t act alike isa break animate human.
    Derived fact

  38. med: Large cell lymphoma is a cancer daughter clone rise origin cll
    Large cell lymphoma isa cancer daughter clone rise origin cll.
    Derived fact

  39. med: Addition rnai clone table 1 induce msi is a causal mutate hnpcc hnpcc like patient
    Addition rnai clone table 1 induce msi isa causal mutate hnpcc hnpcc like patient.
    Derived fact

  40. med: Evid major cancer clone cancer cell represent is a cell possess tumour initiate cell tic function
    Evid major cancer clone cancer cell represent isa cell possess tumour initiate cell tic function.
    Derived fact

  41. med: Complementary dna clone derive transcript unit n is a characterize
    Complementary dna clone derive transcript unit n isa characterize.
    Derived fact

  42. med: Difer age necessarily clone organ environ circumst is a circumst
    Difer age necessarily clone organ environ circumst isa circumst.
    Derived fact

  43. med: Cancer is a clone
    Cancer isa clone.
    Derived fact

  44. med: Shown cc clone cat clone turn like is a clone
    Shown cc clone cat clone turn like isa clone.
    Derived fact

  45. med: x5 10 tumour cell is a clone 4 arisen fig
    5 10 tumour cell isa clone 4 arisen fig.
    Derived fact

  46. med: Bilateral breast pattern breast ovarian bowel endometri is a clone autosom dominion autosom recess x link
    Bilateral breast pattern breast ovarian bowel endometri isa clone autosom domin autosom recess link.
    Derived fact

  47. Corona: The Final pcr product was cloned into the bac infectious clone through an intermediate plasmid containing nt 18404 26049 of the SARS-CoV genome (16, 43).
    Final pcr product isa clone bac infectious clone.
    Derived fact.
    Final_pcr_product_isa_clone_bac_infectious

  48. med: breast cancer nucleic acid identify is a clone constitu part recombine form breast cancer
    Breast cancer nucleic acid identify isa clone constitu part recombine form breast cancer.
    Derived fact

  49. med: Fragment dna is a clone dna vector amplify bacterial host escherichia
    Fragment dna isa clone dna vector amplify bacterial host escherichium.
    Derived fact

  50. med: Foreign dna is a clone host bacteria copy chromosome
    Foreign dna isa clone host bacterium copy chromosome.
    Derived fact

  51. med: Year period mari clair groundbreaking identification is a clone human mice function link dna repair
    Year period mari clair groundbreaking identification isa clone human mouse function link dna repair.
    Derived fact

  52. Corona: These two Fragments were sub-cloned into the pcmv-mcscopgfp vector (clone sites and primers used are listed in Table I), forming the expression plasmids pcmvMCS-upE and pcmv-MCS-1bN.
    Fragment isa clone pcmv mcscopgfp vector clone site.
    Derived fact.
    Fragment_isa_clone_pcmv_mcscopgfp_vector_site

  53. med: Locate chromosome delete retinoblastoma is a clone sequence gene loss critic develop cancerth
    Locate chromosome delete retinoblastoma isa clone sequence gene loss critic develop cancerth.
    Derived fact

  54. med: Individuate hybridoma cell is a clone test find produce desire antibody
    Individuate hybridoma cell isa clone test find produce desire antibody.
    Derived fact

  55. med: Navel orange is a clone tree origin brazil today import industry
    Navel orange isa clone tree origin brazil today import industry.
    Derived fact

  56. med: Author ad study shown is a clone version patient cell enhance immune system
    Author ad study shown isa clone version patient cell enhance immune system.
    Derived fact

  57. med: Identical human twin is a closer duplicate clone egg placenta womb gestate
    Identical human twin isa closer duplicate clone egg placentum womb gestate.
    Derived fact

  58. med: Select cancer epithelioid cell is a complete 4th passage colony clone method
    Select cancer epithelioid cell isa complete 4th passage colony clone method.
    Derived fact

  59. med: Hierarchs model cancer cell populate fits data is a compo distinct clone hand stem cell state
    Hierarch model cancer cell populate fit datum isa compo distinct clone hand stem cell state.
    Derived fact

  60. med: Bilateral breast pattern breast ovarian bowel endometri is a conflict high risk gene clone autosom dominion
    Bilateral breast pattern breast ovarian bowel endometri isa conflict high risk gene clone autosom domin.
    Derived fact

  61. med: Clone erythropoietin produce human hepatocellular carcinoma cell is a conserve mammalian specie
    Clone erythropoietin produce human hepatocellular carcinoma cell isa conserve mammalian specie.
    Derived fact

  62. Corona: Nucleotide sequence accession number 385 The Consensus sequence of seacov-p10 used for construction of the infectious clone has 386 been deposited in GenBank under accession no. MK977618. 387 388 Acknowledgments 389 This work was supported by the National Key Research and Development Program of China 390 (2016YFD0500102), the National Natural Science Foundation of China (31872488), and the 391 Fundamental Research Funds for the Central Universities of China (2019FZA6014).
    Consensus sequence seacov p10 isa construction infectious clone.
    Derived fact.
    Consensus_sequence_seacov_p10_isa_construction_infectious_clone

  63. Corona: The bacterial artificial chromosome (BAC) encoding recombinant Orf3a-deficient sarS-cov was constructed from a previously generated full-length infectious cdna clone (42).
    Orf3a defici sar cov isa constructed previously generated full length infectious cdna clone.
    Derived fact.
    Orf3a_defici_sar_cov_isa_constructed_previously_generated_full_length_infectious_cdna_clone

  64. Corona: Next, an Shrna expression plasmid was constructed through a series of cloning steps (Supplementary Figure 1).
    Shrna expression plasmid isa constructed series cloning step.
    Derived fact.
    Shrna_expression_plasmid_isa_constructed_series_cloning_step

  65. med: G csf stimulate leukemic clone g csf is a contraind generate admit icu set
    G csf stimulate leukemic clone g csf isa contraind generate admit icu set.
    Derived fact

  66. med: Identical human twin closer duplicate clone egg is a copy
    Identical human twin closer duplicate clone egg isa copy.
    Derived fact

  67. Corona: Consensus Sequences were assembled from both forward and reverse Sequences, edited manually, and corrected on the basis of the different clones of a fragment.
    Sequence isa corrected basis different clone fragment.
    Derived fact.
    Sequence_isa_corrected_basis_clone_fragment

  68. Corona: Infectious clones allow the creation of near-homogenous viral stocks, whereas traditional viral stocks are prepared by amplification of Infectious material in cell culture over many passages.
    Infectious clone isa creation homogen viral stock.
    Derived fact.
    Infectious_clone_isa_creation_homogen_viral_stock

  69. med: Locate chromosome delete retinoblastoma clone sequence gene is a critic develop cancerth rb gene
    Locate chromosome delete retinoblastoma clone sequence gene isa critic develop cancerth rb gene.
    Derived fact

  70. Corona: Name Sequence (5? 3?) MERSVLP-upE-F CGAATTCCTACATTCCACTGTTT MERSVLP-upE-R CGTGGATCCCGTTAAACCCACTCGTCAG MERSVLP-1bN-F CGGAATTCTTTTATTACTGCCAATCC MERSVLP-1bN-R TCGGATCCAGGTGACAGTCTTTAACAT Note: Underlining denotes the clone sites. and it contains green fluorescence protein (GFP) as a reporter gene.
    Underlining isa denote clone site.
    Derived fact.
    Underlining_isa_denote_clone_site

  71. Corona: Recombinant wt merS-cov and mutants were derived from the emc/2012 strain cdna clone, all by introducing mutations into cdna fragment F assembling the genome fragment and recovering infectious virus as described previously (27).
    Recombinant wt mer cov mutant isa derived emc 2012 strain cdna clone.
    Derived fact.
    Recombinant_mer_cov_mutant_isa_derived_emc_2012_strain_cdna_clone

  72. Corona: The pBAC-tgev-GFP plasmid containing a Fulllength infectious cdna clone, which was derived from the highly virulent tgev strain wh-1 (genbank accession number HQ462571), has been described previously (19).
    Fulllength infectious cdna clone isa derived highly virulent tgev strain wh 1 genbank.
    Derived fact.
    Fulllength_infectious_cdna_clone_isa_derived_highly_virulent_tgev_strain_genbank

  73. Corona: BHK-21, Vero-E6, LLC-MK2, DBT, 326 293FT, DPP4-expressing Huh7.5 cells, and 17Cl-1 cells were cultured in Dulbecco s 327 modified Eagle s medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) 328 supplemented with 10% fetal bovine serum (FBS; Gibco) and incubated at 37 C in an 329 atmosphere containing 5% CO2. 330 HCoV-OC43 (GenBank accession number: AY391777.1) expressing the Rluc gene 331 (rOC43-ns2Del-Rluc) and derived from an infectious cdna clone (17) was used for HTS in 332 HBK-21 cells.
    Rluc gene isa derived infectious cdna clone.
    Derived fact.
    Rluc_gene_isa_derived_infectious_cdna_clone

  74. med: Malign cell cancer is a descend single origin cell member single clone
    Malign cell cancer isa descend single origin cell member single clone.
    Derived fact

  75. Corona: These Infectious clones were designated macmut, PLP2mut, and 454 MAC/PLP2, according the locations of introduced mutations as shown in Figure 1. 455 Temperature-sensitive assay and one-step growth kinetics.
    Infectious clone isa designated macmut.
    Derived fact.
    Infectious_clone_isa_designated_macmut

  76. med: Author ad study shown clone version patient is a destroy nature
    Author ad study shown clone version patient isa destroy nature.
    Derived fact

  77. med: Compare level env express is a detect dexamethason stimulate 293mmtvmutegfp nonmut 293mmtv clone
    Compare level env express isa detect dexamethason stimulate 293mmtvmutegfp nonmut 293mmtv clone.
    Derived fact

  78. med: Sanger reaction perform template plasmid clone purify is a determine
    Sanger reaction perform template plasmid clone purify isa determine.
    Derived fact

  79. med: Von hippl lindau gene is a develop vhl diseases map clone mutate 57
    Von hippl lindau gene isa develop vhl disease map clone mutate 57.
    Derived fact

  80. med: Criteria combine 12 bac clone t sample is a diagnose cancer 100 sensitize specif learn valid
    Criterium combine 12 bac clone t sample isa diagnose cancer 100 sensitize specif learn valid.
    Derived fact

  81. med: Twelve bac clone dna methyl statue is a discriminate cancer tissue t noncanc pancreatic tissue
    Twelve bac clone dna methyl statue isa discriminate cancer tissue t noncanc pancreatic tissue.
    Derived fact

  82. med: Dna methyl statue 11 bac clone is a discriminate patient show early relap relap learn
    Dna methyl statue 11 bac clone isa discriminate patient show early relap relap learn.
    Derived fact

  83. med: Karyograph is a display number copy chromosome clone cell individuate
    Karyograph isa display number copy chromosome clone cell individuate.
    Derived fact

  84. med: High dose chemotherapy stem cell rescue complete is a due persist chemotherapy resist clone
    High dose chemotherapy stem cell rescue complete isa due persist chemotherapy resist clone.
    Derived fact

  85. med: Implant dna adult cell create clone is a easy
    Implant dna adult cell create clone isa easy.
    Derived fact

  86. med: Identical human twin closer duplicate clone is a egg placenta womb gestate time frame parent
    Identical human twin closer duplicate clone isa egg placentum womb gestate time frame parent.
    Derived fact

  87. med: Goal induct therapy aml is a erad malign clone restore hematopoiesi
    Goal induct therapy aml isa erad malign clone restore hematopoiesi.
    Derived fact

  88. med: Hierarchs model cancer cell populate fits data is a evid cancer compo distinct clone hand stem
    Hierarch model cancer cell populate fit datum isa evid cancer compo distinct clone hand stem.
    Derived fact

  89. Corona: A Total of 24 sub-cloned homogeneous cell populations exhibited higher susceptibility to PEDV infection, as demonstrated by PEDV N protein-speci?c IFA (data not shown).
    Total 24 clone homogeneous cell population isa exhibited higher susceptibility.
    Derived fact.
    Total_clone_homogeneous_cell_population_isa_exhibited_higher_susceptibility

  90. Corona: MERS-CoV maM35C4 is a previously published clonal isolate generated after 35 passages in mice; subsequently plaque purified and Clone 4 was expanded two times on Vero CCL81 cells to obtain our working stock grown in virus collection medium [12].
    Clone 35 isa expanded 4 time.
    Derived fact.
    Clone_isa_expanded_time

  91. med: Brca2 is a express metastasis suppress microcel hybrid clone rb1
    Brca2 isa express metastasis suppress microcel hybrid clone rb1.
    Derived fact

  92. med: clone like twin don t act alike is a extinct clone breed increase number break animate
    Clone like twin don t act alike isa extinct clone breed increase number break animate.
    Derived fact

  93. med: Hybridoma clone is a fuse product cancer cell lymphocyte produce type
    Hybridoma clone isa fuse product cancer cell lymphocyte produce type.
    Derived fact

  94. med: Clone treatment repair damage cell dna is a gain
    Clone treatment repair damage cell dna isa gain.
    Derived fact

  95. med: Support idea expand clone precanc cell tissue is a gene involve dna repair control mutate rate
    Support idea expand clone precanc cell tissue isa gene involve dna repair control mutate rate.
    Derived fact

  96. Corona: Recombinant merscovs were generated by a bacterial artificial chromosome (bac) clone carrying the full-length infectious genome of the EMC isolate (designated as pbac-MERS-wt), as described previously (Terada et al., 2017; Matsuyama et al., 2018) with modifications.
    Recombinant merscov isa generated bacterial artificial chromosome bac clone.
    Derived fact.
    Recombinant_merscov_isa_generated_bacterial_artificial_chromosome_bac_clone

  97. Corona: merS-NS4bH182R encodes NS4b with a Catalytically inactive phosphodiesterase domain, which was generated from the merS-cov infectious clone as previously described (19, 27).
    Catalytically inactive phosphodiesterase domain isa generated mer cov infectious clone.
    Derived fact.
    Catalytically_inactive_phosphodiesterase_domain_isa_generated_mer_cov_infectious_clone

  98. Corona: Deletion mutants mers-?ns4a and mers-?ns4ab were generated from the mers-cov infectious clone derived from the mers-EMC2012 strain (27) as follows and are described in detail in Materials and Methods and diagrammed in Fig. 1A and B.
    Deletion mutant mers- ns4a mers- ns4ab isa generated mers- cov infectious clone.
    Derived fact.
    Deletion_mutant_mers-_ns4a_ns4ab_isa_generated_cov_infectious_clone

  99. Corona: All Infectious clones were generated using the reverse 443 genetics system previously established for MHV-A59 (37).
    Infectious clone isa generated reverse.
    Derived fact.
    Infectious_clone_isa_generated_reverse

  100. Corona: TMPRSS2-/- mice with a homologous genotype were obtained 328 by crossing male and female TMPRSS2+/- C57BL/6 mice (20). 329 The transgenic mice expressing Human dpp4 gene (hdpp4-tg mice) were generated by 330 microinjection of the purified bac clones carrying hdpp4 gene into the pronuclei of 331 fertilized eggs from BDF1 C57BL/6NCr mice (Iwata-Yoshikawa et al., submitted).
    Human dpp4 gene hdpp4 tg mouse isa generated 328 microinjection purified bac clone.
    Derived fact.
    Human_dpp4_gene_hdpp4_mouse_isa_generated_328_microinjection_purified_bac_clone

  101. Corona: After three rounds of screening on plates with different nutrient-deficient media, a Total of 120 blue clones that grew on the sd/?trp/?leu/?
    Total 120 blue clone isa grow sd trp leu.
    Derived fact.
    Total_120_blue_clone_isa_grow_trp_leu

  102. Corona: After three rounds of screening on di?erent nutritionallyde?cient medium plates, a Total of 108 blue clones that grew on the sd/ ?trp/?leu/?ade/-His/X-?-gal/AbA were visible and identi?ed by PCR (Fig. 2B and C).
    Total 108 blue clone isa grow sd trp leu ade - gal.
    Derived fact.
    Total_108_blue_clone_isa_grow_trp_leu_ade_gal

  103. med: Assay clone f2 cross is a heterozyg homozyg alternate api allele propensity produce
    Assay clone f2 cross isa heterozyg homozyg alternate api allele propensity produce.
    Derived fact

  104. med: Clone erythropoietin produce human hepatocellular carcinoma cell is a highly conserve mammalian specie
    Clone erythropoietin produce human hepatocellular carcinoma cell isa highly conserve mammalian specie.
    Derived fact

  105. med: Clone delivery transgenic piglet transgenic donor cell is a hmc
    Clone delivery transgenic piglet transgenic donor cell isa hmc.
    Derived fact

  106. Corona: Thus, this sub-Cloned ipi-fx cell line is an ideal cell model to study the mechanisms of infection, particularly co-infections of swine enteric CoVs. 1.
    Clone ipi fx cell line isa ideal cell model.
    Derived fact.
    Clone_ipi_cell_line_isa_ideal_model

  107. Corona: As shown in Figure 1C and D, the Entire genome sequences of rescued viruses were identical to the cdna clone, including the genetic markers at position 6857, 15616, 23753 and the Emerging Microbes & Infections 21 junctions between six fragments, thereby suggesting that the rPDCoV was successfully rescued in LLCPK1 cells.
    Entire genome sequence rescued viruse isa identical cdna clone.
    Derived fact.
    genome_sequence_rescued_viruse_isa_identical_cdna_clone

  108. med: Twelve bac clone dna methyl statue discriminate is a identify
    Twelve bac clone dna methyl statue discriminate isa identify.
    Derived fact

  109. med: breast cancer nucleic acid is a identify clone constitu part recombine form breast
    Breast cancer nucleic acid isa identify clone constitu part recombine form breast.
    Derived fact

  110. Corona: Assembly of a Full-length cdna clone of pdcov The cloning strategy for a Full-length pdcov cdna clone is illustrated in figure 1A, using six contiguous fragments ?anked by the BsmBI restriction endonuclease sites that leave nonpalindromic overhangs.
    Full length pdcov cdna clone isa illustrated figure.
    Derived fact.
    Full_length_pdcov_cdna_clone_isa_illustrated_figure

  111. med: Study reveal format soft agar clone vitro is a inhibit neutral monoclonal antibody block stimulatory loops20
    Study reveal format soft agar clone vitro isa inhibit neutral monoclonal antibody block stimulatory loops20.
    Derived fact

  112. med: Target dna sequence is a insert clone vector
    Target dna sequence isa insert clone vector.
    Derived fact

  113. med: Typical involve arrange multiple clone site polylink is a insert express gene gene fragment plasmid section
    Typical involve arrange multiple clone site polylink isa insert express gene gene fragment plasmid section.
    Derived fact

  114. med: Allogen stem cell transplant erad abnormal clone is a intol initiate treatment signif treatment relate morbid
    Allogen stem cell transplant erad abnormal clone isa intol initiate treatment signif treatment relate morbid.
    Derived fact

  115. med: Discovery prostate cancer suscept gene characterize posit is a invalu asset clone cancer suscept gene 9
    Discovery prostate cancer suscept gene characterize posit isa invalu asset clone cancer suscept gene 9.
    Derived fact

  116. Corona: All cDNA fragments were synthesized based on PDCoV passage 3 sequence (genbank accession number MF095123.1) and were ligated in the pjet1.2/blunt cloning vector (thermo scienti?c).
    X3 sequence genbank accession number isa ligated pjet1 2 blunt cloning vector thermo scienti.
    Derived fact.
    sequence_genbank_accession_number_isa_ligated_pjet1_blunt_cloning_vector_thermo_scienti

  117. med: Learn animate experiment is a like clone
    Learn animate experiment isa like clone.
    Derived fact

  118. med: clone like twin don t act alike is a like read letter animate extinct clone breed
    Clone like twin don t act alike isa like read letter animate extinct clone breed.
    Derived fact

  119. Corona: These Resistant cell clones were maintained in g418-containing media for 15 days with routine medium replacements until cell death could no longer be observed.
    Resistant cell clone isa maintained g418 medium.
    Derived fact.
    Resistant_cell_clone_isa_maintained_g418_medium

  120. med: Von hippl lindau gene develop vhl diseases is a map clone mutate 57 sporadic renal cell
    Von hippl lindau gene develop vhl disease isa map clone mutate 57 sporadic renal cell.
    Derived fact

  121. med: gene clone is a method identical copy gene insert gene
    Gene clone isa method identical copy gene insert gene.
    Derived fact

  122. Corona: The Purified bac clones were microinjected into the pronuclei of 513 o n January 11, 2019 by guest http://jvi.asm.org/ D ow nloaded from 28 fertilized eggs from BDF1 C57BL/6NCr mice (SLC Inc., Hamamatsu, Japan) and then 514 transplanted into pseudopregnant ICR mice (SLC Inc.).
    Purified bac clone isa microinjected pronuclei 513.
    Derived fact.
    Purified_bac_clone_isa_microinjected_pronuclei_513

  123. med: Support idea expand clone precanc cell tissue is a monitor period month year mutate gene involve
    Support idea expand clone precanc cell tissue isa monitor period month year mutate gene involve.
    Derived fact


© Copyright 2016. YesteryearChronicle all rights reserved. YesteryearChronicle powered by ctSearch